My Eterna PROFILE
Well, friends of this website.. I'm going to be less frequently in this. Or stopping to login. Because I get tired really. Going to softy or weightless task which it does like for God. I think good is out of PC whole time, guess.
DONT TAKE MY DATABASE ON NEW LAB: UGCCUGGCGGGCGUAGCGCGGUGGUCCCACCUCACCCCAUGCCGAACUGAGAAGUGAAACGCCGUAGCGCCGAUGGUAGUGUGGGGUCUCCCCAUGCGAGAGUAGGCAACUGCCAGGCAU
.... I'm lost in my soul.
lroppy: great [4:48 AM]
biologychemistry123: Yay [4:50 AM]
yulan: so much to read...so much to learn... [8:22 AM]
cynwulf28: yes [8:40 AM]
Xnessax: way to inspire, using math on puzzles as like GC is strongest and GU is weakest, you can use some stack which to pair to other stach using ALT. You will think of math-pairing, so you could do many missions like state 1 and state 2 have a difference in connecting and disconnecting a pair. [9:28 AM]
Xnessax: this was what I've thinking yesterday and I solved one puzzle in lab design [9:29 AM]
Thanks for clue ,Astromon: Ziggies explainning
My personal Information
My Arts
Random Animations or stuffs
HIT GODZILLA-NES!!!! IM FAN OF GODZILLA. I WISH MY ANIMATE BECAME REAL MOVIE. 
That means Love.
That means Thank you, Andrew. I'm Fan of Andrew good ideas. :D
This is my romance as this type of rna <3
I am a deaf ,the drawer but i can hear cuz i haave an implant cochlear. And using Opus 2 actived an implant so makes my brain see an image of hearing. But still learning some for hearing... im beginner for it.
Learning html from course, w3school ,advancedHTML.
There're great website to learn html, css, stuffs!
![]()
![]()
![]()
THE FUNNIEST CHAT OMG EVER FUNNIEST BIOLOGY TEACHER LOL:
Astromon: hey ness whats up [9:44 PM] Astromon: oH [9:44 PM] Xnessax: therapy of gens IS AWESOME [9:44 PM] Xnessax: OGM [9:44 PM] Xnessax: OMG [9:44 PM] Xnessax: BioEthic is AWESOME [9:44 PM] Xnessax: i wanna read so badly [9:44 PM] Ramlyn: really? [9:45 PM] Astromon: sounds very interesting [9:45 PM] Xnessax: Veeeery! [9:45 PM] Xnessax: its from my university [9:45 PM] Ramlyn: what is it that makes it so interesting¿ [9:45 PM] Xnessax: :3333 [9:45 PM] Xnessax: idk [9:45 PM] Ramlyn: hahahaha [9:45 PM] Xnessax: they tell new themes [9:45 PM] Xnessax: are so interesting [9:45 PM] Xnessax: LOL [9:45 PM] Ramlyn: my bio teacher keeps complaining about bioethics [9:45 PM] Xnessax: woa [9:45 PM] Xnessax: really [9:45 PM] Xnessax: OMG [9:45 PM] Ramlyn: hahaha [9:46 PM] Xnessax NOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO [9:45 PM] Ramlyn: yeah he doesn’t like it it seems [9:46 PM] Ramlyn: hahahaha [9:46 PM] Xnessax: isn’t there socialog [9:46 PM] Xnessax: it could v [9:46 PM] Xnessax: because he studies and sometime he doesnt have that desire [9:46 PM] Ramlyn: he blames bioethics for the slow improvement of maany areas of biochemistry [9:46 PM] Xnessax: woahh [9:46 PM] Ramlyn: hahaha [9:47 PM] Astromon: hmm [9:46 PM] Xnessax: thats bad [9:47 PM] Ramlyn: idk why he studied bio tbh [9:47 PM] Ramlyn: he doesn’t seem to like it hahahahaha [9:47 PM] Ramlyn: yeah [9:47 PM] Xnessax: woa [9:47 PM] Xnessax: but [9:47 PM] Xnessax: society is great [9:47 PM] Xnessax: it need [9:47 PM] Xnessax: a good faith people [9:47 PM] Astromon: i didnt know i liked it until eterna [9:47 PM] Ramlyn: haha [9:47 PM] Xnessax: they can share intellince bio [9:47 PM] Xnessax: LOL [9:47 PM] Ramlyn: i loved eterna because i like it [9:47 PM] Ramlyn: haha [9:48 PM] Xnessax: and they find some solutions and inisghts to give them [9:47 PM] Xnessax: so they help them to do fast improvement [9:48 PM] Xnessax: they need change the negative to positive [9:48 PM] Ramlyn: hahaha [9:48 PM] Ramlyn: welp [9:48 PM] Xnessax: and use time and think about a time [9:48 PM] Ramlyn: my teacher is such a snob (i think that’s the right term idk) [9:48 PM] Xnessax: it needs an attention about time, use, doing, how it would be seem like, how problem would be and solution [9:48 PM] Xnessax: snob [9:48 PM] Xnessax: ? [9:48 PM] Ramlyn: once i talked with himç [9:48 PM] Ramlyn: about clonning [9:48 PM] Xnessax: bipolar [9:48 PM] Xnessax: derp? [9:49 PM] Xnessax: why he is biology [9:49 PM] Ramlyn: (a old school pesimist person i think) [9:49 PM] Xnessax: could be [9:49 PM] Xnessax: they think so small [9:49 PM] Xnessax: need to think big [9:49 PM] Ramlyn: yeah [9:49 PM] Ramlyn: well we were talking [9:49 PM] Xnessax: think big is used a lot of faith inside it [9:49 PM] Ramlyn: and i askewd him [9:49 PM] Ramlyn: asked* [9:49 PM] Ramlyn: teacher, [9:49 PM] Xnessax: faith is only when you have a way to create it before to do something and see about it [9:49 PM] Xnessax: becasue something will happen you noticed you did wel [9:49 PM] Xnessax: that can’t be viewed so you know is an eternity [9:50 PM] Ramlyn: you talk about clonning and explain it as if it was a simple thing anf that it can be done in sooo many diferent ways and it would work [9:50 PM] Ramlyn: but if that is really so [9:50 PM] Xnessax: many differents [9:50 PM] Xnessax: ways [9:50 PM] Ramlyn: then why are they not applying it [9:50 PM] Xnessax: well it should be analyising [9:50 PM] Xnessax: because some ways dont work and others can work [9:50 PM] Xnessax: like eterna [9:50 PM] Xnessax: puzzle are so [9:50 PM] Xnessax: about it [9:50 PM] Ramlyn: and i explined to him how my own genetics/clonning investigation was going and bla bla bla [9:51 PM] Xnessax: LOL wow [9:51 PM] Ramlyn: and at one moment i said [9:51 PM] Xnessax: my teacher is too strange in that year when i was going to finish my middle school [9:51 PM] Xnessax: biology teacher [9:52 PM] Xnessax: her said i can be mediciene [9:52 PM] Ramlyn: "if it’s so possible and not that complex and accessible, why is it that these days the only clonning used is the same as they did with Dolly the Sheep back then [9:52 PM] Xnessax: ._. [9:52 PM] Xnessax: cuz i said to her i love so much genetics [9:52 PM] Xnessax: Dolly the Sheep LOL? [9:52 PM] Xnessax: wow [9:52 PM] Ramlyn: and h said " oh Dolly that F***ing sheep." and started to talk about bioethics and how that was stopping improvmente and bla bla bla hate hate hate ahahahaha [9:53 PM] Xnessax: your teacher explained that like my teacher explained same thing omg [9:53 PM] Xnessax: it was about a sperm [9:53 PM] Xnessax: ro something [9:53 PM] Xnessax: like it thinks ti can be on ice and to not die [9:53 PM] Xnessax: up to other year to make it clonning [9:53 PM] Xnessax: it looks like dangerous [9:53 PM] Xnessax: i doubt the cell could die [9:53 PM] Xnessax: it has the deadline [9:53 PM] Ramlyn: well yeah [9:54 PM] Xnessax: my teacher is sometime pessimist as your teacher [9:54 PM] Ramlyn: he talks about identical reproduccion as if it was the easiest most natural thing ever [9:54 PM] Astromon: seeya guys late gtg for a while! [9:54 PM] Xnessax: she was all mad with students and explain so seriously [9:54 PM] Astromon: have fun! [9:54 PM] Xnessax: Seeya! Thanks [9:54 PM] Astromon: so glad we are working on the art presentation again this year<<< [9:54 PM] Xnessax: i finished writting for my university ,the theme of phubbing and problem caused to relationships. so i also finished activity 2 so i didnt finish it yet at button “finish it now” [9:55 PM] Xnessax: I need some share ideas with classmates if i get right answers [9:55 PM] Xnessax: or they agree them [9:56 PM] Ramlyn: hahaha he once said “one day, well run out of men! and woman will reproduce by themselves. taking the thing inside you medula (idk the correct name in english) and adding it to their egg and hence creating a baby clone you” all i could think was “THAT’S SICK BRO WTHHHHHH” [9:56 PM] Xnessax: medula i understand [9:56 PM] Xnessax: in portuguese LOL [9:56 PM] Ramlyn: HAHAHA LOL [9:56 PM] Ramlyn: YE [9:56 PM] Ramlyn: oops caps [9:56 PM] Xnessax: thats funny [9:56 PM] Ramlyn: yeah [9:57 PM] Xnessax: they check if the cell is in fecundation [9:57 PM] Xnessax: would be to pick on it with other female or something maybe not sperm it was kinda possible ,weird. but i dont remenber, it was at 2014 i finished at 2015 [9:57 PM] Xnessax: ops 2014* [9:57 PM] Ramlyn: he just talks and talkes about that and then screams “BUT THANKS TO BIOETHICS, NONE OF THIS WILL BE MADE” HAHAHAHAHAHA ATTENTION: POLITICS SUCKS. BRAINWASH IS A WHY I WAS GOING TO VOTE OR YELL EVERYONE VOTE IN DACIOLO CABO, WHY HE IS LESS POPULAR BETTER THAN LAST POPULAR. I DON'T CARE IF PEOPLE LAUGH OUT ABOUT HIM BY SAYING GLORAYYY, BUT HE'S NOT SHOWING THE REAL OF HIM. HE SHOWED THE POLICITS STEAL OUR LIFE AND BEST PEOPLE FOR HELPING THEM TO GET MONEY AND KILL COUNTRIES. 6:54 PM] Xnessax: Now Jair has india, europe and Brazil maybe [6:54 PM] Xnessax: I saw that on TV [6:54 PM] Xnessax: Or some where [6:54 PM] Korosi: thats how the media works [6:54 PM] Xnessax: Yea [6:55 PM] Xnessax: They forced people to vote it [6:55 PM] Xnessax: As a church said how works that fake “Good man” want to get over the power [6:55 PM] Xnessax: Like an evilness, not complied tasks in own countries for people life [6:56 PM] Korosi: now we’ve got the “impeachment” [6:55 PM] Xnessax: it looks like it wnt work [6:56 PM] Xnessax: i saw my old friend posts that said trump isnt worried about impeachment [6:56 PM] Xnessax: He learned from Dilma [6:56 PM] Xnessax: I saw that posts that is now impeachmentD [6:56 PM] Korosi: yeah [6:56 PM] Xnessax: omg sorry discuting politics [6:57 PM] Xnessax: lol [6:57 PM] Xnessax: politics is so boring [6:57 PM] Astromon: I think the people will wake up and decide in the next election. [6:57 PM] Korosi: some people have on chat [6:57 PM] Xnessax: its brainwash [6:57 PM] Xnessax: influences are kinda dangerous, they can get up to people [6:57 PM] Xnessax: but if people get connection with other in conscious how works with bible or their opinions [6:58 PM] Xnessax: As max [6:58 PM] Xnessax: problem is a division [6:59 PM] Xnessax: my supervisoer in job that said its fake news!! I said that bolsonaro will not comply stuffs in country [6:59 PM] Xnessax: and “fake news!” again [6:59 PM] Xnessax: Darp. [6:59 PM] Korosi: yeah [6:59 PM] Astromon: yeah its very easy just to say “this is fake news” [6:59 PM] Xnessax: a friend who works in that, she said that bolsonaro will be a bad fight, violence more [7:00 PM] Astromon: there are ways to fact check [7:00 PM] Xnessax: thats totally fact i already saw in RIO that why bolsonaro let (police)people violencing up [7:01 PM] Xnessax: overviolencing [7:01 PM] Xnessax: killing a good guy [7:01 PM] Xnessax: I was like why that killed it without a conscicous
Jesus is a true path, he's going to back to our Earth. He calling us to get a faith as in attitudes and in our mind... Get it before you get for playing or feel for your heart trick, like satan want you like yourself not love. It's near. Let's make some love that is true not dirty, I hope I will be loved to love someone, i'm searching for truth God's man.


Comentários
Postar um comentário